ID: 1001557734_1001557738

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1001557734 1001557738
Species Human (GRCh38) Human (GRCh38)
Location 5:172647828-172647850 5:172647852-172647874
Sequence CCCAACTAGGACTCAGGCTCCTG CTCATCTGCCTGGTAAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 203} {0: 1, 1: 0, 2: 2, 3: 16, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!