ID: 1001563228_1001563237

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1001563228 1001563237
Species Human (GRCh38) Human (GRCh38)
Location 5:172683647-172683669 5:172683699-172683721
Sequence CCGCGTCGTCGCCGGCGCTACTG CGGGCCCGACGTGAGCCTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40} {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!