ID: 1001563301_1001563308

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1001563301 1001563308
Species Human (GRCh38) Human (GRCh38)
Location 5:172683968-172683990 5:172684009-172684031
Sequence CCGTGCCGAGCGGCGGCGACGCG CCCGGCGGCGACGTGCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 60} {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!