ID: 1001563510_1001563515

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1001563510 1001563515
Species Human (GRCh38) Human (GRCh38)
Location 5:172685213-172685235 5:172685261-172685283
Sequence CCTGACACTGGTTTAATCAGTGG TGTCTTCATGAGGGCAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 124} {0: 1, 1: 0, 2: 2, 3: 23, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!