ID: 1001590021_1001590026

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1001590021 1001590026
Species Human (GRCh38) Human (GRCh38)
Location 5:172858766-172858788 5:172858799-172858821
Sequence CCACAGAAAGAAAACAGGGCTGG GGGCCCTGCCCAAGATTCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!