ID: 1001592995_1001592999

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1001592995 1001592999
Species Human (GRCh38) Human (GRCh38)
Location 5:172879125-172879147 5:172879138-172879160
Sequence CCGAGATTCGTCTGCAAGAACAG GCAAGAACAGGGGAGAACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72} {0: 1, 1: 0, 2: 2, 3: 13, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!