ID: 1001594806_1001594815

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1001594806 1001594815
Species Human (GRCh38) Human (GRCh38)
Location 5:172891332-172891354 5:172891382-172891404
Sequence CCAGTGGCTCCATCCTCTTCCCT GTCTGGTATGTTTAACAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 91, 4: 606} {0: 1, 1: 0, 2: 3, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!