ID: 1001598066_1001598078

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1001598066 1001598078
Species Human (GRCh38) Human (GRCh38)
Location 5:172911013-172911035 5:172911065-172911087
Sequence CCCTAGACTTGTCAGCGAGTGGA AGCCGTCCCTCTGCCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45} {0: 1, 1: 1, 2: 2, 3: 36, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!