|
Left Crispr |
Right Crispr |
| Crispr ID |
1001598339 |
1001598346 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:172912888-172912910
|
5:172912923-172912945
|
| Sequence |
CCTCCCAAGTAGCTGGGATTACA |
CATGCCCAGCTAATGTTTTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 48952, 1: 142577, 2: 242332, 3: 522592, 4: 386712} |
{0: 1, 1: 14, 2: 93, 3: 267, 4: 521} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|