ID: 1001604536_1001604544

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1001604536 1001604544
Species Human (GRCh38) Human (GRCh38)
Location 5:172950608-172950630 5:172950626-172950648
Sequence CCTTGCAGAGCCCATCATCTCAT CTCATGATGTGGGAGGGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 138, 4: 2591} {0: 1, 1: 0, 2: 6, 3: 135, 4: 1376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!