ID: 1001609130_1001609135

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1001609130 1001609135
Species Human (GRCh38) Human (GRCh38)
Location 5:172985738-172985760 5:172985758-172985780
Sequence CCATCCTGTTTCCACTTAGCCCT CCTAGAGAGTGTCATGATTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 319} {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!