ID: 1001650688_1001650694 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1001650688 | 1001650694 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:173313941-173313963 | 5:173313983-173314005 |
| Sequence | CCCCAAGCCTCGTGTAAAATAGG | ACTTAAAAATAAATTTAAAGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 24, 3: 255, 4: 1887} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||