ID: 1001652787_1001652802

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1001652787 1001652802
Species Human (GRCh38) Human (GRCh38)
Location 5:173327670-173327692 5:173327718-173327740
Sequence CCGGGGACCCTCTGGGCCTCCCG TTGCACCGGACCCGGGATTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 378} {0: 1, 1: 0, 2: 0, 3: 0, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!