ID: 1001660645_1001660651

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1001660645 1001660651
Species Human (GRCh38) Human (GRCh38)
Location 5:173390198-173390220 5:173390238-173390260
Sequence CCCCAGGGGTGAAAAATGTGGGC ATTTTCCACATTGTAAGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 25, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!