ID: 1001688529_1001688536

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1001688529 1001688536
Species Human (GRCh38) Human (GRCh38)
Location 5:173614789-173614811 5:173614806-173614828
Sequence CCCTCCCCCCTCAGGGGATACGT ATACGTTCCAAGATCCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74} {0: 7, 1: 65, 2: 398, 3: 623, 4: 750}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!