ID: 1001688529_1001688537

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1001688529 1001688537
Species Human (GRCh38) Human (GRCh38)
Location 5:173614789-173614811 5:173614807-173614829
Sequence CCCTCCCCCCTCAGGGGATACGT TACGTTCCAAGATCCCCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74} {0: 2, 1: 5, 2: 22, 3: 61, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!