ID: 1001690489_1001690490

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1001690489 1001690490
Species Human (GRCh38) Human (GRCh38)
Location 5:173629276-173629298 5:173629301-173629323
Sequence CCTCTCTTGGGAGGTGACATTTG CTAAGACCTAAATAACAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 8, 3: 39, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!