ID: 1001709729_1001709732

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1001709729 1001709732
Species Human (GRCh38) Human (GRCh38)
Location 5:173768566-173768588 5:173768579-173768601
Sequence CCTCAGTTCTGCCACTTGCTAGC ACTTGCTAGCCATATGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 28, 3: 178, 4: 635} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!