ID: 1001734643_1001734650

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1001734643 1001734650
Species Human (GRCh38) Human (GRCh38)
Location 5:173988727-173988749 5:173988770-173988792
Sequence CCCACGCAGTGACCGGCTGCCTC TCCCTCCAGCCCCCCAGCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 55, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!