ID: 1001750987_1001750992

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1001750987 1001750992
Species Human (GRCh38) Human (GRCh38)
Location 5:174131257-174131279 5:174131309-174131331
Sequence CCTAGGAAGGTGCAGTCTCAGGG ATTCATAAGAATCAGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 242} {0: 1, 1: 0, 2: 3, 3: 35, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!