ID: 1001760562_1001760566

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1001760562 1001760566
Species Human (GRCh38) Human (GRCh38)
Location 5:174204626-174204648 5:174204674-174204696
Sequence CCTAATATCACAGATGGGAAAGA TCATAGAGACTATGCTGTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 432} {0: 1, 1: 0, 2: 0, 3: 17, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!