ID: 1001784467_1001784470

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1001784467 1001784470
Species Human (GRCh38) Human (GRCh38)
Location 5:174400292-174400314 5:174400320-174400342
Sequence CCTAGTGTAGGCAAGTTCATGTA AAAGCAGAATGGTGGTTGCCAGG
Strand - +
Off-target summary No data {0: 36, 1: 399, 2: 1508, 3: 3159, 4: 4983}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!