ID: 1001805450_1001805452

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1001805450 1001805452
Species Human (GRCh38) Human (GRCh38)
Location 5:174581717-174581739 5:174581730-174581752
Sequence CCCGGGAGAGGAAAGTAGTTGTG AGTAGTTGTGACTGACTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 418} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!