ID: 1001805451_1001805454

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1001805451 1001805454
Species Human (GRCh38) Human (GRCh38)
Location 5:174581718-174581740 5:174581754-174581776
Sequence CCGGGAGAGGAAAGTAGTTGTGA ATCTGCACTTGTTTCTAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 289} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!