ID: 1001815782_1001815785

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1001815782 1001815785
Species Human (GRCh38) Human (GRCh38)
Location 5:174668336-174668358 5:174668355-174668377
Sequence CCTCAGGCCACCTGTTTGCAACC AACCTCTATATTCATTGTAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 26, 4: 246} {0: 1, 1: 0, 2: 2, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!