ID: 1001829521_1001829525

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1001829521 1001829525
Species Human (GRCh38) Human (GRCh38)
Location 5:174773914-174773936 5:174773929-174773951
Sequence CCTCTCTCTTGGGAATGGGCTTG TGGGCTTGAAAGCTCGGATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!