ID: 1001889821_1001889828

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1001889821 1001889828
Species Human (GRCh38) Human (GRCh38)
Location 5:175329487-175329509 5:175329535-175329557
Sequence CCAGTGGGGTCAGAGCCAGAAAC CCCACGGCTCCTCTATGCAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!