ID: 1001891950_1001891957

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1001891950 1001891957
Species Human (GRCh38) Human (GRCh38)
Location 5:175347001-175347023 5:175347025-175347047
Sequence CCCTCCAAACATCCATCAGAGCC TTCCTAAGGAATCATGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 187} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!