ID: 1001891952_1001891957

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1001891952 1001891957
Species Human (GRCh38) Human (GRCh38)
Location 5:175347005-175347027 5:175347025-175347047
Sequence CCAAACATCCATCAGAGCCCTTC TTCCTAAGGAATCATGTCTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!