ID: 1001970965_1001970967

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1001970965 1001970967
Species Human (GRCh38) Human (GRCh38)
Location 5:175954595-175954617 5:175954620-175954642
Sequence CCAGCAATGGGGCAAAGGGAGGC CATTAACATTCAGGTTAGAGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 202} {0: 2, 1: 0, 2: 0, 3: 4, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!