ID: 1002015034_1002015035

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1002015034 1002015035
Species Human (GRCh38) Human (GRCh38)
Location 5:176314358-176314380 5:176314384-176314406
Sequence CCACATAGCTTGAATGAGTTTTC CAAGACCAACAGACTTCCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!