ID: 1002021379_1002021394

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1002021379 1002021394
Species Human (GRCh38) Human (GRCh38)
Location 5:176366127-176366149 5:176366156-176366178
Sequence CCCATCCCCTCCCGCCTGCGGTC CCGAGACCGGTGGAGGAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 231} {0: 1, 1: 0, 2: 0, 3: 25, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!