ID: 1002033557_1002033567

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1002033557 1002033567
Species Human (GRCh38) Human (GRCh38)
Location 5:176448322-176448344 5:176448359-176448381
Sequence CCGTTCAGACCGGATGTGGTTGT CCGGCGGGTGACGGTGCGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68} {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!