ID: 1002038444_1002038445

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1002038444 1002038445
Species Human (GRCh38) Human (GRCh38)
Location 5:176491990-176492012 5:176492005-176492027
Sequence CCTGAACAGGCAATAGAATAACA GAATAACACTTGCTGCTTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 219} {0: 1, 1: 0, 2: 1, 3: 20, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!