ID: 1002048584_1002048592

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1002048584 1002048592
Species Human (GRCh38) Human (GRCh38)
Location 5:176556058-176556080 5:176556096-176556118
Sequence CCTGCAACCCAGCCACAGGGACC GAATACACCTGGTTCTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 41, 4: 296} {0: 1, 1: 0, 2: 1, 3: 7, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!