ID: 1002053205_1002053213

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1002053205 1002053213
Species Human (GRCh38) Human (GRCh38)
Location 5:176583691-176583713 5:176583729-176583751
Sequence CCAGCTCTGACTGAGCACAGAGC AGTTGTGTGCAGGAGGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 337} {0: 1, 1: 0, 2: 0, 3: 25, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!