ID: 1002060086_1002060091

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1002060086 1002060091
Species Human (GRCh38) Human (GRCh38)
Location 5:176620810-176620832 5:176620838-176620860
Sequence CCTACGCCTCTGGCTCATACTCC TTCCTCCTGCATCACCGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 224} {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!