ID: 1002065640_1002065648

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1002065640 1002065648
Species Human (GRCh38) Human (GRCh38)
Location 5:176650420-176650442 5:176650441-176650463
Sequence CCTCTGGACCAATCCCCGGGGCA CAGGTGAAGGCGGAGCATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90} {0: 1, 1: 0, 2: 1, 3: 18, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!