ID: 1002072502_1002072511

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1002072502 1002072511
Species Human (GRCh38) Human (GRCh38)
Location 5:176688489-176688511 5:176688526-176688548
Sequence CCTGTCTGTTCCTGGCCCCACAA TCGGATCCGCAGCCAGGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!