ID: 1002075311_1002075321

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1002075311 1002075321
Species Human (GRCh38) Human (GRCh38)
Location 5:176705042-176705064 5:176705086-176705108
Sequence CCTGTGTTTCCTAGAGAAGCCAC CTCAGCTCTCAGCACAGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!