ID: 1002093939_1002093944

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1002093939 1002093944
Species Human (GRCh38) Human (GRCh38)
Location 5:176819897-176819919 5:176819933-176819955
Sequence CCAGGCACAGCCTGTGGCTCAGA CTGGATCAACACTATTTTATTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 49, 4: 407} {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!