ID: 1002105484_1002105490

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1002105484 1002105490
Species Human (GRCh38) Human (GRCh38)
Location 5:176877645-176877667 5:176877671-176877693
Sequence CCAGCCCTGACAGCTGGAGCCTG CTCAAAAAGCAGTCGTGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 503} {0: 1, 1: 0, 2: 0, 3: 6, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!