ID: 1002108572_1002108581

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1002108572 1002108581
Species Human (GRCh38) Human (GRCh38)
Location 5:176892692-176892714 5:176892741-176892763
Sequence CCTATTGCCCCAAACTGGACACT CTGGATAATAAGGCCGCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!