ID: 1002123353_1002123358

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1002123353 1002123358
Species Human (GRCh38) Human (GRCh38)
Location 5:177022793-177022815 5:177022810-177022832
Sequence CCTTACAGCAGCTCGGAGTTGCT GTTGCTGGAGGGCCAGGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} {0: 1, 1: 0, 2: 5, 3: 52, 4: 519}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!