ID: 1002139946_1002139949

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1002139946 1002139949
Species Human (GRCh38) Human (GRCh38)
Location 5:177132619-177132641 5:177132636-177132658
Sequence CCGAGGTGCGGACGCGCTGTCAG TGTCAGGCTGCAGCCCGGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41} {0: 1, 1: 0, 2: 6, 3: 100, 4: 599}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!