ID: 1002139971_1002139978

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1002139971 1002139978
Species Human (GRCh38) Human (GRCh38)
Location 5:177132702-177132724 5:177132718-177132740
Sequence CCCGCGGAGGCCACGGCCGGGCG CCGGGCGAGCAGTGCCGGGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!