ID: 1002158771_1002158775

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1002158771 1002158775
Species Human (GRCh38) Human (GRCh38)
Location 5:177303009-177303031 5:177303033-177303055
Sequence CCAAATACCTAATGTCACAGTCC GTCTCCGACCGACATCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119} {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!