ID: 1002160732_1002160738

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1002160732 1002160738
Species Human (GRCh38) Human (GRCh38)
Location 5:177312571-177312593 5:177312588-177312610
Sequence CCCAAGCCTGCCTGCCATCTGCC TCTGCCCCCGAAGGCCCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 427} {0: 1, 1: 0, 2: 0, 3: 22, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!