ID: 1002174361_1002174369

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1002174361 1002174369
Species Human (GRCh38) Human (GRCh38)
Location 5:177393217-177393239 5:177393252-177393274
Sequence CCTTACACCCCCTGAGGATAAGG GGAGAATGGAGCTTGAGCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 82} {0: 1, 1: 0, 2: 2, 3: 26, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!