ID: 1002175785_1002175791

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1002175785 1002175791
Species Human (GRCh38) Human (GRCh38)
Location 5:177400378-177400400 5:177400395-177400417
Sequence CCACGCTCAGGCCCGCCTGCAGG TGCAGGAAGGTGTGCCTGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 250} {0: 1, 1: 0, 2: 1, 3: 19, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!